Research ArticleINFLAMMATION

IL-23–producing IL-10Rα–deficient gut macrophages elicit an IL-22–driven proinflammatory epithelial cell response

See allHide authors and affiliations

Science Immunology  14 Jun 2019:
Vol. 4, Issue 36, eaau6571
DOI: 10.1126/sciimmunol.aau6571
  • Fig. 1 IL-10R-deficient macrophages secrete IL-23, inducing IL-22 secretion by ILC3 and TH17 cells.

    (A) Volcano plot of statistical significance (−log10 P value) against log2 ratio of macrophages sorted from the colonic lamina propria of 6- to 7-week-old Cx3cr1creIl10rafl/fl and Cx3cr1gfp/+ mice, based on RNA-seq data. Significantly up- or down-regulated genes (fold change, >2; adj. P < 0.05) are in black, and relevant proinflammatory up-regulated genes are highlighted in red. Data are representative of two independent experiments, n ≥ 3 for each group. (B) RNA-seq–normalized read numbers for single genes of interest are plotted separately; each dot represents one mouse. (C) qRT-PCR analysis of Il23p19 expression by sorted colonic macrophages from 6- to 7-week-old mice (left) or of Il22 expression (right) in colonic whole-tissue extracts of 6- to 7-week-old indicated mice, including antibiotics (Abx) treatment. Data were collected from two independent experiments, n ≥ 3 in each group. (D) qRT-PCR analysis of Il17 expression in colonic whole-tissue extracts of indicated mice. Data were collected from two independent experiments, n ≥ 3 in each group. (E) Whole-mount staining of colonic tissue of Cx3cr1cre:Il10rafl/fl:Rorgtgfp mice and Cre-negative littermates (age, 3 to 4 months), analyzed by confocal microscope, GFP in green, and CD3 in red. Indent in the bottom is in the white rectangle. Scale bars, 50 μm (top) and 20 μm (bottom). (F) Representative picture of flow cytometry analysis and sorting strategy of Cx3cr1cre:Il10rafl/fl:Rorgtgfp mice and Cre-negative littermates 3 to 4 months old. (G and H) qRT-PCR analysis of RNA extracted from sorted colonic TH17 cells (F) or ILC3s (G) for indicated genes. Data were collected from two independent experiments, n = 3 in each group. *P ≤ 0.05.

  • Fig. 2 The response of ECs to proinflammatory macrophages.

    (A) Weight and colonoscopic analysis of [Cx3cr1cre:Il10rafl/fl > WT] or [Cx3cr1gfp/+ > WT] BM chimeras. Colonoscopy was performed 7 weeks after transplant. Data are representative of three independent experiments, n ≥ 3 for each group. *P < 0.05. (B) Representative picture of microscopic analysis of [Cx3cr1gfp > Villincre:R26-tdTomato] BM chimera. (C) Representative picture of flow cytometry analysis and sorting strategy of ECs from [Cx3cr1gfp > Villincre:R26-tdTomato] BM chimera. (D) Description of BM chimera experiment and timeline of EC harvest. (E) Volcano plots of statistical significance (log10 P value) against log2 ratio of ECs sorted from the colon of [Cx3cr1cre:Il10rafl/lf > Villincre:R26-tdTomato] BM chimeras and Villincre:R26-tdTomato mice, based on RNA-seq data. Significantly up- or down-regulated genes (fold change, >2; adj. P < 0.05) are in black and Il-22–induced genes are highlighted in red. Data were collected from one experiment, n ≥ 3 for each group. (F) Heatmap of RNA-seq data of colonic and ileal ECs extracted from the same mouse. Normalized reads number were log-transformed. Presented are genes of interest, significantly up-regulated in colonic but not in ileal ECs in response to proinflammatory macrophages at both disease stages [day 14 (d14) and d60 after transplant)]. (G) qRT-PCR analysis of Reg3b, Reg3g, Cxcl1, and Cxcl5 expression in whole-tissue extracts of colons of 6- to 7-week-old mice. Data were collected from two independent experiments, n ≥ 3 in each group.

  • Fig. 3 IL-23 deficiency prevents the colitogenic activity of IL-10R mutant macrophages.

    (A) Heatmap of RNA-seq data of colonic macrophages sorted from 6- to 7-week-old mice. Normalized read numbers were log-transformed. (B and C) Volcano plots of statistical significance (log10 P value) against log2 ratio of macrophages sorted from the colonic lamina propria of (B) Cx3cr1cre:Il10rafl/fl and Cx3cr1gfp/+ mice or (C) Cx3cr1cre:Il10rafl/fl:Il23afl/fl and Cx3cr1gfp/+ mice, based on RNA-seq data. Significantly up- or down-regulated genes (fold change, >2; adj. P < 0.05) are in black, and relevant proinflammatory up-regulated genes are highlighted in red. In (B), data are representative of two independent experiments (B) or from one experiment (C), in each experiment, n ≥ 3. (D) Colonoscopic (left) and histopathological (right) analysis of 3- to 4-month-old mice. Data were collected from two independent experiments, n ≥ 3 in each group. (E) Representative images of histopathological analysis of indicated mouse strains. (F) qRT-PCR analysis of Il23a expression by sorted colonic macrophages of indicated mouse strains (left) or Il22, Nos2, and Reg3b expression in colonic whole-tissue RNA extracts of indicated mouse strains. Data were collected from two independent experiments, n ≥ 3 in each group. All mice were age-matched; each dot represents one mouse. n.s., non significant, P > 0.05; *P ≤ 0.05.

  • Fig. 4 IL-22 is critical for colitis driven by IL-10R-deficient macrophages.

    (A) Colonoscopic (left) and histopathological (right) analysis of 3- to 4-month-old mice. (B) Representative images of histopathological analysis of indicated mouse strains. Scale bar, 100 µm. (C) qRT-PCR analysis of Il22, Cxcl1, Cxcl5, Reg3b, Reg3g, and Nos2 expression in colonic whole-tissue extracts of indicated mouse strains. (D) qRT-PCR analysis of Il23a and Ccl5 by sorted colonic macrophages of indicated mouse strains (left), and whole-tissue Il17a levels of indicated mouse strains. (E) Flow cytometry analysis and quantification of lamina propria T cells extracted from the colons of indicated mouse strains. Data in (A), (C), (D), and (E) were collected from two independent experiments, n ≥ 3 in each group. All mice were age-matched; each dot represents one mouse.

  • Fig. 5 Definition of the cellular source of IL-22.

    (A) Weight and colonoscopic analysis of [Cx3cr1cre:Il10rafl/fl > WT], [Cx3cr1gfp/+ > WT], or [Cx3cr1cre:Il10rafl/fl:Il-22−/− > WT] BM chimeras. Colonoscopy was performed 6 weeks after transplant. n.s., non significant, P > 0.05; *P ≤ 0.05. Data were collected from two independent experiments, n ≥ 3 in each. (B) qRT-PCR analysis of Il22, Cxcl1, and Cxcl5 expression in whole-tissue extracts of colons of indicated BM chimeric mice. Data were collected from two independent experiments, n = 3 to 5 in each group. (C) qRT-PCR analysis of Il22 expression in whole-tissue extracts of colons of indicated BM chimeric mice. Data are from one of two representative experiments. Weight (left) and colonoscopic (right) analysis of [Cx3cr1cre:Il10rafl/fl:Il22−/− > WT] and [Cx3cr1cre:Il10rafl/fl:Il22−/− > Il22−/−] BM chimeras. Colonoscopy was performed 7 weeks after transplant. Weight data are from one of two representative experiments, n = 3 to 4 in each group; colonoscopic data are collected from two experiments. n = 3 to 4 in each group. (D) Flow cytometry analysis of the lamina propria of [Cx3cr1cre:Il10rafl/fl > Rorgtgfp] and [Il10rafl/fl > Rorgtgfp] BM chimeras. Tcrb, T cell receptor beta chain. Data are representative of three experiments, n = 3 to 5 in each group. (E) qRT-PCR analysis of Il22 expression by sorted TH17 cells from indicated BM chimeras. Data were collected from three independent experiments, n = 3 to 5 in each group. (F) Weight and colonoscopic analysis of [Cx3cr1cre:Il10rafl/fl > WT] or [Cx3cr1cre:Il10rafl/fl > Il-22−/−] BM chimeras. Colonoscopy was performed 6 weeks after transplant. Data were collected from two independent experiments, n ≥ 3 in each group. (G) qRT-PCR analysis of Il22 and Cxcl5 expression in whole-tissue extracts of colons of indicated BM chimeric mice. Data were collected from two independent experiments, n = 3 to 5 in each group.

  • Fig. 6 Neutrophil recruitment to the colonic lamina propria depends on CD4+ T cells.

    (A) Representative plots of flow cytometry analysis of the colonic lamina propria of indicated mouse strains. (B) Quantification of flow cytometry analysis according to gating strategy indicated in (A). n.s., non significant, P > 0.05; *P ≤ 0.05. (C) Representative plots of flow cytometry analysis of the colonic lamina propria of Cx3cr1cre:Il10rafl/fl mice (left). Quantification of flow cytometry analysis (right). (D) Schematic of T cell depletion protocol. (E) Quantification of flow cytometry analysis of mesenteric LNs indicating efficient ablation of CD4+ T cells but not CD8+ T cells. (F) Representative plots of flow cytometry analysis of the colonic lamina propria of [Cx3cr1cre:Il10rafl/fl > WT] BM chimeras. (G) Representative immunofluorescence images of colon sections of [Il10rafl/fl > WT], [Cx3cr1cre:Il10rafl/fl > WT], and [Cx3cr1cre:Il10rafl/fl > WT] BM chimeras treated with the anti-CD4 regimen. Scale bars, 50 μm. (H) qRT-PCR analysis of Il22, Cxcl1, and Cxcl5 expression in whole-tissue extracts of colons of indicated BM chimeric mice. Data are collected from two independent experiments, n ≥ 3 in each group.

  • Fig. 7 Neutrophil depletion ameliorates colitis in Cx3cr1cre:Il10rafl/fl BM chimeras.

    (A) Schematic of neutrophil depletion protocol. (B) Representative plots of flow cytometry analysis of the colonic lamina propria of [Cx3cr1cre:Il10rafl/fl > WT] BM chimeras treated with IgG control or anti-Ly6G antibody (left). Quantification of flow cytometry analysis (right). *P ≤ 0.05. (C) Representative immunofluorescence images of the colonic tissue of [Cx3cr1cre:Il10rafl/fl > WT] BM chimeras treated with IgG control or anti-Ly6G antibody. Scale bars, 50 µm. (D) qRT-PCR analysis of Nos2 expression in whole-tissue extracts of colons of indicated BM chimeric mice. (E and F) Volcano plot of statistical significance (log10 P value) against log2 ratio of macrophages isolated from colonic tissue of [Cx3cr1cre:Il10rafl/fl > WT] BM chimeras treated with IgG control (F) or anti-Ly6G antibody (E) and [Il10rafl/fl > WT] BM chimeras, based on RNA-seq data. Significantly up- or down-regulated genes (fold change, >2; adj. P < 0.05) are in black, and relevant proinflammatory up-regulated genes are highlighted in red. Data in (A) to (D) are collected from two independent experiments, n ≥ 3 in each group.

  • Table 1 Primers used in qPCR.

    GeneForward (5′->3′)Reverse (5′->3′)
    ActbGGAGGGGGTTGAGGTGTTTGTGCACTTTTATTGGTCTCA
    TBPGAAGCTGCGGTACAATTCCAGCCCCTTGTACCCTTCACCAAT
    Reg3bACTCCCTGAAGAATATACCCTCCCGCTATTGAGCACAGATACGAG
    Reg3gATGCTTCCCCGTATAACCATCAGGCCATATCTGCATCATACCAG
    Nos2CTGCAGCACTTGGATCAGGAACCTGGGGAGTAGCCTGTGTGCACCTGGAA
    Il22ATGAGTTTTTCCCTTATGGGGACGCTGGAAGTTGGACACCTCAA
    Il23ATGCTGGATTGCAGAGCAGTAACGGGGCACATTATTTTTAGTCT
    Ccl5AGATCTCTGCAGCTGCCCTCAGGAGCACTTGCTGCTGGTGTAG
    Cxcl5TGCGTTGTGTTTGCTTAACCGCTTCCACCGTAGGGCACTG
    Cxcl1GACCATGGCTGGGATTCACCGTGTGGCTATGACTTCGGTT

Supplementary Materials

  • immunology.sciencemag.org/cgi/content/full/4/36/eaau6571/DC1

    Fig. S1. Gating strategies and transcriptome analysis of animals exposed to antibiotics.

    Fig. S2. Transcriptome analysis of ECs of Villincre:R26-tdTomato mice.

    Fig. S3. Lack of neutrophil infiltrates in the lamina propria of Cx3cr1cre:Il10rafl/fl:Il23afl/fl mice.

    Fig. S4. Macrophage-derived Il23a is critical for colitis induction in the BM chimera model.

    Fig. S5. Chimerism of blood monocytes and T cells.

    Fig. S6. Analysis of NEi-treated BM chimeras.

    Fig. S7. Analysis of transcriptomes of macrophages retrieved from BM chimeras treated with control IgG or neutrophil-depleting anti-Ly6G antibody.

    Fig. S8. Summary schematic illustrating the finding of this study.

    Data file S1.

    Data file S2.

  • Supplementary Materials

    The PDF file includes:

    • Fig. S1. Gating strategies and transcriptome analysis of animals exposed to antibiotics.
    • Fig. S2. Transcriptome analysis of ECs of Villincre:R26-tdTomato mice.
    • Fig. S3. Lack of neutrophil infiltrates in the lamina propria of Cx3cr1cre:Il10rafl/fl:Il23afl/fl mice.
    • Fig. S4. Macrophage-derived Il23a is critical for colitis induction in the BM chimera model.
    • Fig. S5. Chimerism of blood monocytes and T cells.
    • Fig. S6. Analysis of NEi-treated BM chimeras.
    • Fig. S7. Analysis of transcriptomes of macrophages retrieved from BM chimeras treated with control IgG or neutrophil-depleting anti-Ly6G antibody.
    • Fig. S8. Summary schematic illustrating the finding of this study.

    Download PDF

    Other Supplementary Material for this manuscript includes the following:

    Files in this Data Supplement:

Stay Connected to Science Immunology

Navigate This Article